Starygamergirl13 Starygamergirl13

04-02-2020
Mathematics

contestada

Please help!! I don't know what to do :(
Find the value of x. Show all your work for full credit.

Please help I dont know what to do Find the value of x Show all your work for full credit class=

Respuesta :

04-02-2020

Yo sup??

This question can be solved by applying the properties of similar triangles

the triangle with sides 5x and 20 is similar to the triangle with sides 45 and 36

therefore we can say

5x/45=20/36

x=5 units

Hope this helps

Answer Link

Otras preguntas

Rick was so successful with his sweet treats franchise that he opened several other sweet treats locations. rick could best be described as:

Write about the formation of Himalayas

The archetypes established in ancient mythology A. explain scientific phenomena. B. capture historical facts. C. provide ideas for improved cultural interac

I really need help! 25 points and I'll give brainliest. Thanks! 1. Describe the main events and leaders of the Punic Wars. 2. Write a short paragraph that di

During the cross-bridge cycle, after the calcium binds to troponin, what happens next?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How did southern slaveholders claim that the North benefited from slavery? 1. They demonstrated that slavery was the foundation of the entire American economy.

The federal government's insurance program for the elderly and disabled is called:

What is the value of c?

Tick the option that shows how the words 'where my nan lives' are used in the sentence. On holiday, we drove through the village where my nan lives. 1)as a rela