iitanox8682 iitanox8682
  • 01-04-2020
  • Business
contestada

Interest expense would be classified on a multiple-step income statement under the heading

Respuesta :

Zviko
Zviko Zviko
  • 03-04-2020

Answer:

Non-Operating Expenses

Explanation:

The multiple-step income statement reports separately Incomes derived from Primary Activities of the Company commonly known as Operating Income and Incomes derived from Secondary activities of the Company known as Non-Operating Income.

Interest expense is part of secondary activities of the company and thus classified under Non-Operating Expenses.

Answer Link

Otras preguntas

the diagram of a circle is 2 feet. what is the radius?
What is a parabola graph
Help me I’m new I’m in 8th
Are 3 eggs the same quantity as 3 dozen eggs ?
Why did the unemployment rate go down from 1933 to 1937?
The population of a town is increasing at a rate of 2.8% per year. In 2001 the town had a population of 34,229. Find the population of the town in 2013
What are some things that parents need?
What temperature would 3.54 moles of xenon gas need to reach to exert a pressure of 1.57 atm at a volume of 34.6 l
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
A 70-liter tank of oxygen gas at 27 degree Celcius and 42.0 atm springs a leak overnight. when the tank was found in the morning, the pressure in the tank had d