laneycasey355 laneycasey355
  • 01-04-2020
  • History
contestada

The United States and Canada have the same standard of living as most of the world.

True or false?

Respuesta :

gabriel515
gabriel515 gabriel515
  • 01-04-2020
False. In many other countries, there are orphanages for kids to be held in such as England or Mexico. Here in Canada and the US, we have a lot better living conditions for a child without a home such as having foster parents or being adopted.
Answer Link

Otras preguntas

Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
what's the percentage of 1/8 ?
testosterone directly affects the
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
Graph the first six terms of a sequence where a1 = -10 and d = 3.
the reproductive system of a male mammal provides