acarr1325
acarr1325 acarr1325
  • 03-08-2020
  • Mathematics
contestada

What is the slope of side AC?

What is the slope of side AC class=

Respuesta :

wegnerkolmp2741o
wegnerkolmp2741o wegnerkolmp2741o
  • 03-08-2020

Answer:

The slope is  ( d-b)/ ( c-a)

Step-by-step explanation:

To find the slope we can use the slope formula

m = ( y2-y1_/(x2-x1)

  = ( d-b)/ ( c-a)

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the end behavior of the function f(x) = −x3 + 2x2 + 4x + 5? A. Up on the left, up on the right. B. Up on the left, down on the right. C. Down on the lef
The Hellenistic age was characterized by all of the following EXCEPT
what's the ph of citric acid
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Let f(x) = 2x + 2. Solve f−1(x) when x = 4. a. 1 b.3 c. 4 d.10
Find the measure of an exterior angle of each regular polygon: 100-gon.
can someone help me please
Which molecule carries the instructions for producing mrna? a. trna b. dna polymerase c. dna d. rna polymerase?
paul has a standard deck of cards. what is the probability he will choose a 2?