yasini0144 yasini0144
  • 01-10-2020
  • History
contestada

What is the meaning of the word emancipate?

Respuesta :

andersonshayna19
andersonshayna19 andersonshayna19
  • 02-10-2020

Answer:

To be legally set free.

Explanation:

Answer Link

Otras preguntas

Which one of the following choices best represents an appropriate warm-up exercise? A. Toe touches B. Supine leg lifts C. Hip extensions
What role does the House of Representative have in the impeachment process?
The textbook defines _____ as a cluster of characteristics that are associated with all members of a specific social group, often including qualities that are u
A penny fell off the top of the building and hit the sidewalk below 3.1 seconds later how many meters did the penny fall to the sidewalk
what is the most important factor that holds a gene pool of a species together and prevents speciation?
Simplify the expression: (5a^4b^2)^3(-2b^4)
While the theme of "Ode on a Grecian Urn" focuses on how art is eternal, the theme of "Ozymandias" focuses on how a.royalty is superior. b.nature endures. c.thi
Solve the equation. Identify any extraneous solutions. x=sqrt2x+24 6 and 4 are both extraneous solutions. 4 is a solution to the original equation. The value –6
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What plane contains points C, D, and G? Question 12 options: The plane on the bottom of the figure The plane on the top of the figure The plane on the front sid