lisettebe lisettebe

02-10-2016
Mathematics

contestada

Why is every prime number greater than 2 an odd number?

Respuesta :

christopherloga christopherloga

02-10-2016

Cause if a number is greater than 2 is an odd number is because it isn't equal to 2.

Answer Link

Otras preguntas

What does the word "Islam" mean?

What is the domain of the this function?

Please help me with this

Which one of the following will likely be revealed in the inspection report? A. school attendance zone B. termite damage C. age of the property D. liens

At age 76 years, which chronic condition is elizabeth most likely to have?

What is the distance between 407 squared and negative 68 squared

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

I WILL MARK BRAINIEST AND GIVE 50 POINTS 4. Analyze what would happen to this ecosystem if one of the primary consumers was removed from the ecosystem? What wou

I=$310 P==$1,000 t=5 years

Adele earns about $15 each day in tips as a waitress. If she saves $7.50 of it, how many workings days will ot take her to save $225 ?