oscarcrackedmason oscarcrackedmason
  • 02-02-2021
  • Mathematics
contestada

100 decreased by a
number k equals 44

Respuesta :

THEHAPPYHEAD
THEHAPPYHEAD THEHAPPYHEAD
  • 02-02-2021

Answer:

56

Step-by-step explanation:

Answer Link
Jupiter09
Jupiter09 Jupiter09
  • 02-02-2021

Answer:

k=56

Step-by-step explanation:

100-44=56

100-56=44

Answer Link

Otras preguntas

the members of an animal community are usually similar in
The wealth and prosperity of mali and songhai were dependent on controlling the trade in
If you tell a friend you don't have any money to lend him when in reality you do, you're demonstrating which of the "reasons for lying"?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
PLEASE HELP!!!!!!!!!!!!!!! Mongol conquests ranged from East Asia to Eastern Europe during the thirteenth and fourteenth centuries. This relatively short period
NEED HELP PLEASE WORTH 15 POINTS Which equation would best help solve the following problem? The height of a triangle is 4 m less than its base. The area of the
stars and planets are made from gases in a
What did Theodore Roosevelt do before he was elected president at the age of 42?
Pete slid a domino off a bridge and it took 2.3 seconds to hit the Gully below how many feet did the domino fall
Everyone in the neighborhood has been complaining about the deteriorating condition of the park, but nobody has cleaned it up. why not