sheradensears sheradensears

01-03-2021
Mathematics

contestada

Which ordered pair is a solution of the equation: y = x + 3 a) (-2,5) b) (3,0) c) (8, 11)

Respuesta :

Yang100 Yang100

01-03-2021

Answer:

C) (8, 11)

Step-by-step explanation:

8+3=11.

Answer Link

Otras preguntas

Find the measure of an exterior angle of each regular polygon: 100-gon.

The chloroplast found within a photosynthetic protist is surrounded by four membranes. how can we account for this

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A transit train from Boston to New York and a passenger train from New York to Boston departed at the same time, at 3:00 PM. The distance between New York stati

With the two endpoints of a diamter how many right triangles can be formed

The learning curve describes the ________ relationship between ________ and ________

The learning curve describes the ________ relationship between ________ and ________

What country did Texas break away from to become independent?

Exponential Equation WITHOUT CALCULATOR

Who is largely responsible for the spread of hellenistic culture in the 4th century bc?