video4all video4all
  • 04-03-2021
  • Biology
contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult
  • 04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

Who can change voter qualifications?
Bret wants to plot a graph to show the prices of different numbers of skateboards. He has to plot the following points: (1, 49.99), (2, 99.98), (3, 149.97), (4,
3 1/2 into an improper fraction
what are the three major factors that influence underage drinking
Guys, I heard a noise in the room next to my room. But nobody is downstairs (that where I am)... what do I do? Please help me.
How should the sentence be revised to replace the infinitives with gerunds? Check all that apply.
Can a mutation be beneficial to an organism? No. Any change to existing DNA is harmful. No. because mutations are caused by exposure to harmful radiation. Yes.
How does a wavelength determine the speed of a wave?
what has the same level of nutrients as grapefruit?
Help me! 22 POINTS The ordered pair (0,14) is solution of the inequality y > - x + 12. True False