Seudónimo Seudónimo
  • 01-12-2016
  • Mathematics
contestada

It takes 60 minutes for 7 people to paint 5 walls.
How many minutes does it take 10 people to paint 10 walls?

Respuesta :

Аноним Аноним
  • 01-12-2016
0.7/1 of a wall per person
Answer Link

Otras preguntas

where are the three parts of an atom located
How many years does an apple tree live useful?
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how do i find the angles on a kite?
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
Please answer theses division problems!! 9 divided by 3/7