Jesusistheanswer777
Jesusistheanswer777 Jesusistheanswer777
  • 04-06-2021
  • Mathematics
contestada

What is the surface area of the right rectangular prism?

What is the surface area of the right rectangular prism class=

Respuesta :

allthegirlslubleo allthegirlslubleo
  • 04-06-2021

Answer: i dunno

Step-by-step explanation: realy

Answer Link

Otras preguntas

Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
the bombing of Hiroshima and Nagasaki resulted in
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
does a human body use neon???
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
Do all your pet's offspring look the same? If no, then explain why they look different.
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take