ynityanand13 ynityanand13

01-07-2021
Physics

contestada

A flag pole 18m high casts a shadow 9.6m long . Find the distance of top of pole from the far of end of Shadow.

Respuesta :

Аноним Аноним

01-07-2021

Answer:

[tex]{ \bf{pythogras \: theorem :}} \\ \\ { \tt{ = \sqrt{ {9.6}^{2} + {18}^{2} } }} \\ = 20.4 \: cm[/tex]

Answer Link

Otras preguntas

Towards the end of Anne's diary, her entries stop being about her relationship with Peter and focuses more on what? the burglaries in the house the food

What central idea does wollstonecraft explicitly state in this passage? a lack of education will not make women care only about household issues. women are natu

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

what is the relationship between hitech and hipaa

When did christianity become the official religion of the roman empire?

[xtra points] [urgent] Jim wants to buy two books for $10.00 each. By what percent is the total cost of the two books reduced during the sale?

Illinois senator who believed slavery question should be settled by popular sovereignty

Which statement best describes Washington’s economy in the decades following World War II? A. Economic activity flattened and stagnated. B. Economic activity i

How many significant figures are there is the numerical value: 0.00019?

Which statements describe instances of harassment rather than bullying? Check all that apply. Chen is often ridiculed because he is Asian. Kaylee is often teas