rayadams2021 rayadams2021
  • 01-09-2021
  • History
contestada

How did the film Birth of a Nation help revive the Klan?

Respuesta :

biggielittle64
biggielittle64 biggielittle64
  • 01-09-2021

Answer:

In spite of its divisiveness, The Birth of a Nation was a huge commercial success and profoundly influenced both the film industry and American culture. The film has been acknowledged as an inspiration for the rebirth of the Ku Klux Klan, which took place only a few months after its release.

Answer Link

Otras preguntas

who was the founder of Pennsylvania?
what is the most common type of vegetation throughout Latin America
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
3+1/4x greater than 11
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
who was the founder of Pennsylvania?
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.