ruyarr62 ruyarr62
  • 03-10-2021
  • English
contestada

5 sentences routine about myself …. thankss

Respuesta :

grepr2008
grepr2008 grepr2008
  • 03-10-2021

Answer:

I cant write a routine about YOU because i dont know your routine

Explanation:

Answer Link

Otras preguntas

A bookshelf contains 9 mysteries, 7 biographies, and 4 science fiction books. A book is randomly selected, not replaced, then another is selected. Find the prob
What is the quotient of [picture below]?
What do you call it when an audience laughs at a joke in a play? I know it's called applaud when people clap, but I was wondering if there was a word for the la
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
The difference of 2 numbers is 16. The sum of those numbers is 22 what are the 2 number
A cylinder has a radius of 8 centimeters and a height of 12 centimeters. A smaller cylinder has linear dimensions that are one-fourth the dimensions of the larg
Based on the following​ information, what is the balance on the current​ account? Exports of goods and services​ = $12 billion Imports of goods and​ services= $
explain what the 35ppm specification means
Which of the following are reported at fair value except trading securities: a) held-to-maturity securities b) available-for-sale securities c) all of these opt
A container has 21.5L of helium gas at a pressure of 245 kPa and a temperature of 315K. How many moles of helium are in the container?