mejoradoemilio29 mejoradoemilio29
  • 03-03-2022
  • Spanish
contestada

Que es el español culto en america

Respuesta :

witchofmysticfalls10
witchofmysticfalls10 witchofmysticfalls10
  • 03-03-2022

Answer:

El español de América o español americano es el conjunto de variedades del castellano o español que se habla en el continente americano desde la llegada de los españoles a finales del siglo XV y principios del siglo XVI hasta la actualidad, y conforma el 90 % de los hispanohablantes del planeta

Explanation:

Answer Link

Otras preguntas

How much heat is released when 30g of water at 96 C cools to 25 C
A student cuts a twig of a plant. After making the cut, the student observed a drop ofwater collected at its end. What could be the reason for the appearance of
Operating speed of an automatic washing machine is 5.5 rad s-1 . After loading dirty clothes and pressing a start button, the tub of the washer can reach its op
5. What is the greatest common factor of 12 and 16? A 2 C 12 B 4 D 48
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
whos the first person to propose the concept of an atom?
which statement is true about provider information on the chronic condition verification form?
What is the least common multiple of 10 and 7
Hi, which is the correct answer?
Which important event occurs in the second trimester? (1 point) The developing human can begin to move its arms and legs. The face of the developing human start