mckenziejackson52 mckenziejackson52

01-04-2022
English

contestada

Combine the two sentences into one sentence

Combine the two sentences into one sentence class=

Respuesta :

Studentier Studentier

01-04-2022

Answer: Shihuangdi wanted to travel around China, so he built roads and canals.

Explanation: Use a comma to connect the two into one sentence.

Answer Link

Otras preguntas

20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit

CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n

Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor

Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?

31+34=90-n 45+1=70-k 6×9=41+m

Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?

Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage