tookie6702 tookie6702

02-06-2022
Business

contestada

Advertising, fashion trends, and new product introductions serve to.

Respuesta :

beinggreat78 beinggreat78

02-06-2022

Answer:

Create consumer demand.

Explanation:

Advertising helps promote your product so people will want to buy it.

Answer Link

Otras preguntas

Carbohydrates are an important macronutrient for fueling muscles. during exercise, where can the body obtain carbohydrate?

Boris has scored 80, 93, 63, 83, and 83 on his previous five tests. what score does he need on his next test so that his average (mean) is 79?

The root word graph means to _____. speak, write, read

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which of the following statements is true regarding the Central Limit Theorem? The samples are dependent. The sample size is small. The sample mean is not no

What central idea does wollstonecraft explicitly state in this passage? a lack of education will not make women care only about household issues. women are natu

The _____________________ solved the most difficult problem of the convention, including how the states would be represented in the new congress.

zach has 8 stores that he manages 6 of those stores are hiring what fraction of his stores are hiring?

How do you find x ????

The roman cubitus is an ancient unit of measure equivalent to 0.554m . Convert 2.22/m height of basketball forward to cubiti