LaMarquez
LaMarquez LaMarquez
  • 02-02-2017
  • Mathematics
contestada

Solve the inequality
7x<5x-8

Respuesta :

gigi030198
gigi030198 gigi030198
  • 02-02-2017
7x<5x-8 (subtract the 5x)

7x-5x<-8

2x<-8 (then divide the 2)

2x/2<-8/2

x<-4

I hope this helps :)


Answer Link

Otras preguntas

Groups that are more formal and require less continuous interaction are known as what type of​ group?
which combination of quarks produces a neutral baryon
What is the line of reflection for the trapezoids? A. x = 3 B .y = 3 C. x-axis D. y-axis
What is the solution 4x+1y ≤48 and 10 ≤y ?
which statement about nuclear fusion is correctA) Two hydrogen electrons become protons during fusion B) Helium nuclei xan fuse to form electrons such as nitrog
Mrs. Collins is at the table with you and states that the fourth-degree graphs she has seen have four-real zeros. She asks you if it is possible to create a fou
Determine the total time that must elapse until only 1/16 of an original sample of th-234 remains unchanged.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
As the mother of a late-maturing boy, betty is concerned because, when compared to early-maturing boys, late maturers are more likely to ________.
Mrs. smith underwent an arthrodesis of her spine for spinal deformity, posterior approach, segments l3-l5. what procedure code is reported