JaquaiW132278 JaquaiW132278
  • 03-11-2022
  • Mathematics
contestada

Which angle forms a linear pair with

Which angle forms a linear pair with class=

Respuesta :

AvramN137157 AvramN137157
  • 03-11-2022

A linear pair angle must add up to 180 degrees. The angle that form a linear pair with angle MON is expressed below

[tex]\begin{gathered} \angle MON+\angle QOM=180\text{ degre}es \\ \text{therefore} \\ \angle MON\text{ and }\angle QOM\text{ are linear pair} \end{gathered}[/tex]

Answer Link

Otras preguntas

What is the difference between a settler an an explorer social studies?
At the height of the vietnam war, the united states stationed approximately how many troops in vietnam?
What is the solution 4x+1y ≤48 and 10 ≤y ?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the density of a liquid that has a volume of 20.0 ml and a mass of 330 grams?
PLEASE HELP!!!! Only 8 of those will match up
Read the passage from “Cruel Tribute.” Years passed by. Every spring when the roses began to bloom seven youths and seven maidens were put on board of a black-s
the push or pull that exists between interacting objects is
What is mitochondria
What is the name for the transfer of genetic information from one bacterium to another bacterium by a phage? select one: a. transduction b. translation c. penet