macwilliamsss6477 macwilliamsss6477

02-11-2017
Social Studies

contestada

A quick attempt to locate potential victims who may be in danger is a(n) __________.

Respuesta :

Penguin84 Penguin84

02-11-2017

your answer is primary search.

Answer Link

Otras preguntas

What features of the setting of the temple of Apollo at Delphi help you understand its meaning and importance?

Give an example of Close Rhyme (two rhyming words that are consecutive or very close together in a phrase or line) from a poem. Has to be from a poem.

Select the sentence which has corrected the double negative accurately in the following sentence. We haven't been to no ball games in over a month. We have been

Okolona College ordered jerseys to sell at the homecoming game. The college paid $9.25 each for 225 jerseys. Each jersey was sold for $15.75. what was the perce

in the balcony of a theatre there are 420 seats. the number of seats in each row is 14 more than the number of rows. find the number of rows

a) How did consumers spend their 2008 tax cut (News, p. 237 in your textbook)? b) Does it matter what they spend it on, in terms of impact on Aggregate Demand

Write an equation of the line that passes through point (-1, 5) and has the slope m = 4.

Which changes were viewed as positive changes that took place during Reagan’s presidency? Which were viewed as negative changes

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

2 Points is the term used to describe the study of motion.