babylindsey3803 babylindsey3803
  • 04-04-2018
  • History
contestada

One striking result of post war youth culture was that science forums

Respuesta :

Dante117
Dante117 Dante117
  • 15-04-2018
The fact was that the girls of the postwar period were getting married at the younger age than before.

After the US Civil War up to 1940s the common age of the girls that married was between 22 and 24 years. In the years after the war, according the US Census Bureau, according to the 1950 census the age of the girls who got married was, statistically, 20.5 years. 
Answer Link

Otras preguntas

When did Christianity become the official religion for the Roman Empire
Using the images or terms, describe how parts of a cell interact to export proteins.
235u92 and 238u92 are examples of _____. select one: a. particles of radiation b. allotropes c. tracers d. isotopes
The bretton woods system ended in select one: a. 1945. b. 1973. c. 1981. d. 2001.
what's the ph of citric acid
Which hormone is essential to our ability to maintain our fluid levels?
a chef uses 4 3/4 cups of broth for 10 servings of soup. How much broth is used in one serving of soup?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which of the following excerpts from Fast Food Nation best provides evidence that fast food restaurants are designed for using unskilled labor? Her family’s mo
Use factoring to simplify the expression x^2-x-6/x-3 assume that x does not equal 3