SARGEDOG
SARGEDOG SARGEDOG
  • 03-05-2018
  • Mathematics
contestada

What is the measure of x

What is the measure of x class=

Respuesta :

diazpat004 diazpat004
  • 03-05-2018
it is 172 degrees, because you multiply 86 by 2
Answer Link

Otras preguntas

The equation x 2 + 10 x + 25 = 0 has one solution. Group of answer choices True False
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Katrina has satisfied all of her basic needs: she has a warm home, plenty of food, a loving spouse, and a great job with many opportunities for growth and succe
why would establishing an agricultural college be a way to enhance a country's rate of development?​
Write 3 synonyms and 3 antonyms and the definitions and a sentence for the word Burlap.
The Campbell Company is considering adding a robotic paint sprayer to its production line. The sprayer's base price is $970,000, and it would cost another $19,5
Help! Due soon!!!!!!!!!
A supervisor must split 60 hours of overtime between five people. One employee must be assigned twice the number of hours as each of the other four employees. H
Which is an outer planet?
A 12-year bond of a firm in severe financial distress has a coupon rate of 12% and sells for $920. The firm is currently renegotiating the debt, and it appears