Seudónimo Seudónimo
  • 02-03-2016
  • English
contestada

Who says the following and why? Consort! What! Dost thou make us minstrels? an thou

Respuesta :

wingedruby
wingedruby wingedruby
  • 02-03-2016
It is said by MERCUTIO In Act 3, scene 1, page 3. 
Answer Link
zbeth3e3
zbeth3e3 zbeth3e3
  • 02-03-2016
It is said by Mercutio from Romeo and Juliet.
He says it because he is taken aback by Benvolio's ignorance.
Answer Link

Otras preguntas

Step by step directions Square root for 480
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
Please help with Algebra 1
Please answer theses division problems!! 9 divided by 3/7
is a centimeter one tenth or one hundredth or a meter
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5