kahnyejgreenlee14
kahnyejgreenlee14 kahnyejgreenlee14
  • 03-11-2020
  • History
contestada

What was the reason behind establishing the Middle Colonies

Respuesta :

Аноним Аноним
  • 03-11-2020
The Middle colonies, like Delaware, New York, and New Jersey, were founded as trade centers, while Pennsylvania was founded as a safe haven for Quakers. The Middle colonies were also called the “Breadbasket colonies” because of their fertile soil, ideal for farming.
Answer Link

Otras preguntas

How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
Why did the American public mostly oppose joining the League of Nations after WWI?
A light bulb converts electrical energy into electromagnetic energy is true or false?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
Companies raise funds to expand their business by
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
Graph the first six terms of a sequence where a1 = -10 and d = 3.
the perimeter of a square 116ft ?