landamark20020
landamark20020 landamark20020
  • 03-01-2021
  • Computers and Technology
contestada

Determining Correct Date Function What function text would you use to put today's date and time in a cell? 0 =TODAYO =NOWO O NOWO) O TODAYO​

Respuesta :

jayilych4real
jayilych4real jayilych4real
  • 20-06-2022

The function text that would you use to put today's date and time in a cell is B. =NOW()

What is a Time and Date Function?

This refers to the command that is given to a computer in order for it to render the correct time and date in a given cell.

Hence, we can see that from the answer choices, the best one that factors in both TIME AND DATE is =NOW() which is option B while option A is for the function that shows only the current date.

Read more about date functions here:

https://brainly.com/question/19416819

#SPJ1

Answer Link

Otras preguntas

Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
the reproductive system of a male mammal provides
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
Please help with Algebra 1
what is the percent change from 70 to 56?
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
who was the founder of Pennsylvania?
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5