AlbertHawt AlbertHawt
  • 02-02-2021
  • Mathematics
contestada

I need help solving this.
Thank you too those who respond

I need help solving this Thank you too those who respond class=

Respuesta :

Axgk2323
Axgk2323 Axgk2323
  • 02-02-2021

Answer:

Its D on edge because yes im 100% right

Answer Link

Otras preguntas

Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
in what area of Europe were the majority of warsaw pact countries
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
what's the percentage of 1/8 ?
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place