AmicruzE9oyou AmicruzE9oyou
  • 02-12-2016
  • Mathematics
contestada

I need to find the answer to a factor tree of 56

Respuesta :

ewags520 ewags520
  • 02-12-2016
     56
   28  2
 14 2 | 2
7 2 | 2 | 2

or 

    56
  14 4
7 2 | 2 2
Answer Link

Otras preguntas

how can you write 0.45 as fraction and a percentage ,please show work
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what rule does static electricity follow
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
The Panama Canal connects what two bodies of water?