sharbrit1609 sharbrit1609
  • 03-12-2021
  • Mathematics
contestada

Explain too,thank you

Explain toothank you class=

Respuesta :

Kakitzu
Kakitzu Kakitzu
  • 03-12-2021

In 1/6 hour, 1/10 inch of snow fell.

So to find the unit rate per hour, we need to make a proportion.

[tex]\frac{\frac{1}{6} }{\frac{1}{10} } = \frac{1}{x}[/tex]

1/6 is 10 minutes out of an hour so 6/6 or 1 would be an hour.

We can cross multiply. 1/10 * 1 = 1/10, 1/6 * x = 1/6x

1/6x = 1/10

Divide both sides by 1/6 to isolate x.

x = 3/5

Every hour, 3/5 inch of rain will fall.

Answer Link

Otras preguntas

Write expression using the distributive property to find the product of 7 times 63
Give a recursive algorithm for finding the sum of the first n odd positive integers.
solve the simultaneous equation 4x+7y=1 3x+10y=15
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
four yardequal Blank feet
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What are the factors of 6x + 24?
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for