MrClutch2898 MrClutch2898
  • 03-07-2017
  • Social Studies
contestada

Whats the differnce between religious and schizophrenia?

Respuesta :

pizzaparty576 pizzaparty576
  • 03-07-2017
religious means you believe there is a higher power than all of human kind while schizophrenia is when you are seeing/hearing things that are not there like demons or people.
Answer Link

Otras preguntas

(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
a summary about concussions
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
the bombing of Hiroshima and Nagasaki resulted in
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
Which word has the long i sound? relieve speciality society social
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
How much money, in dollars, does one mole of nickels represent?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5