Yeetadab3545 Yeetadab3545

03-09-2017
Mathematics

contestada

If mary ellen invest x dollars at 5%, write an equation that describes the total interest

Respuesta :

bdowd557 bdowd557

03-09-2017

.05x = total interest

Answer Link

Otras preguntas

20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit

Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa

how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters

How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take

Why did the American public mostly oppose joining the League of Nations after WWI?

What statement best describes a republic?

A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.

A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system

all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5