giannirogers05 giannirogers05
  • 03-11-2017
  • Mathematics
contestada

Which graph represents a line with a slope of and a y-intercept equal to that of the line y = x – 2?

Respuesta :

luckydice44
luckydice44 luckydice44
  • 03-11-2017
drawl a line going through (0,-2) and (2,0) and that's your graph


Ver imagen luckydice44
Answer Link
Thisiscoolmydude Thisiscoolmydude
  • 03-11-2017
It's B because of the points intercepting on the Y axis
Answer Link

Otras preguntas

Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
The Panama Canal connects what two bodies of water?
4.2meters= how many centimeter
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
4(3-5)=-2(8-z)-6z what is z
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5